Primer3 0.4.0 Site
Here's an example output from Primer3:
Here's an example input for Primer3:
PRIMER_PAIR_1: FORWARD_PRIMER: 5'-atgccatgccatgccatgc-3' REVERSE_PRIMER: 5'-gcgggtaccgggatcc-3' FORWARD_TM: 65.2 REVERSE_TM: 66.1 FORWARD_GC: 50% REVERSE_GC: 55% In this example, Primer3 has designed a primer pair with forward primer sequence 5'-atgccatgccatgccatgc-3' and reverse primer sequence 5'-gcgggtaccgggatcc-3' , with melting temperatures of 65.2°C and 66.1°C, respectively. primer3 0.4.0
SEQUENCE_ID: MY_SEQUENCE SEQUENCE: atgccatgccatgccatgccatgccatgcc PRIMER_OPT_TM: 65 PRIMER_MIN_TM: 60 PRIMER_MAX_TM: 72 PRIMER_OPT_SIZE: 20 PRIMER_MIN_SIZE: 18 PRIMER_MAX_SIZE: 24 PRIMER_MIN_GC: 40 PRIMER_MAX_GC: 60 PRIMER_PAIR_SPECIFICITY: high Here's an example output from Primer3: Here's an